GC Content Calculator from XTRAW Tools
new

GC Content Calculator

Calculate GC content percentage of a DNA or RNA sequence. Use this free browser-based gc content calculator from XTRAW Tools.

GC Content Calculator helps you calculate GC content percentage of a DNA or RNA sequence. Use this free browser-based calculator from XTRAW Tools to compare inputs, estimate results, and plan your next step.

How to Use the GC Content Calculator

  1. Enter the required calculator inputs shown in the form.
  2. Review the biology, genetics, lab, microscope, asphalt, paver, sand, or base-material assumptions.
  3. Run the calculator, then adjust one input at a time to compare scenarios or check your estimate.

What This Calculator Helps With

Calculate GC content percentage of a DNA or RNA sequence. It is designed for students, teachers, biology learners, genetics users, lab users, healthcare reference users, STEM tutors, and anyone working with biology or lab formulas who want a fast browser-based estimate before relying on a textbook, lab software, supplier chart, contractor estimate, science reference, professional source, or specialist.

  • DNA/RNA Sequence: ATGCGATCGATCGCTAGCTAGC

Common Uses

People use this calculator when they need a quick way to estimate protein mass, GC content, reverse complements, DNA melting temperature, or sequence-related values.

  • Math Solving: Solve biology, genetics, microscopy, biochemistry, construction, or material-estimating equations from entered values.
  • Measurement: Measure sequence composition, allele frequency, enzyme activity, microscope magnification, cell density, paving volume, paver count, or base material quantities.
  • Unit Conversion: Convert or relate DNA, protein, construction volume, material weight, and practical measurement values.

Formula or Method

GC% = (G + C) / total bases × 100

Example

Example inputs: DNA/RNA Sequence: ATGCGATCGATCGCTAGCTAGC

Example result: Using the default sequence, GC content is 54.55% (12 GC bases out of 22 total bases).

Related Tools

GC Content Calculator FAQ

Is the GC Content Calculator free?

Yes. This calculator is free to use on XTRAW Tools.

Do I need to create an account?

No. XTRAW tools are designed for browser-based use without requiring an account.

Are the results exact?

Results may be estimates depending on the inputs, formula, rounding, lab method, sequence conventions, construction assumptions, waste factor, material density, or purpose of the calculator. Always verify important results before relying on them.

Disclaimer: This calculator is provided for general informational, educational, and convenience purposes only. It is not medical, clinical, laboratory, biological safety, chemical handling, legal, financial, academic, regulatory, or professional advice. Always verify important results with a qualified professional, instructor, biologist, lab supervisor, safety documentation, authoritative source, or appropriate specialist before making decisions.

Category

Best seller